These are the primers we use for cloning (GR1 and GR2 are examples) and sequencing (GR3-9) the human GR ligand binding domain

GR1 ggcgccgGGATCCCCTCTGAAAAT
For the PCR subcloning of the glucocorticoid receptor ligand binding domain with BamHI restriction sites on the ends. Amplifies nt 1647-2479.

GR2 gcggcgggcaGGATCCACTTTTGAT
For the PCR cloning of the human glucocorticoid receptor ligand binding domain with BamHI sites on the ends (nt 1647-2479) This is the reverse primer. Note that Hollenberg et al(PNAS 1993) has the OTHER strand published (the incorrect strand).

GR3 ATTGCAGCAGTGAAATG
For sequencing the human glucocorticoid receptor ligand binding domain

GR4 ACCCTGCATGTACGACCAAT
For sequencing the human glucocorticoid receptor ligand binding domain. Forward primer

GR5 GAAACTCCAGCCAGAAC
For sequencing the ligand binding domain of the human glucocorticoid receptor.Forward primer.

GR6 TCACCAATCAGATACCAAAAT
For sequencing the ligand binding domain of the human glucocorticoid receptor. Forward primer.

GR7 ATCCTGCATATAACACTTC
For sequencing the human glucocorticoid receptor ligand binding domain. Reverse primer (sequence the 5' junction).

GR 8 CACTTCATGCATAGAATC
for sequencing GR constructs.

GR 9 GAAACATACAGCATGTG
sequencing of GR constructs.